The role of serotonin in feeding and gut contractions in the honeybee

Alice S. French

, Kerry L. Simcock

, Daniel Rolke

, Sarah E. Gartside

, Wolfgang Blenau

Geraldine A. Wright

⇑

Centre for Behaviour and Evolution, Institute of Neuroscience, Newcastle University, Newcastle upon Tyne NE1 7RU, UK

Department of Biochemistry and Biology, University of Potsdam, Potsdam D-14476, Germany

Department of Cell Biology and Neuroscience, Goethe University Frankfurt, Oberursel D-61440, Germany

article info

Article history:

Received 26 September 2013

Received in revised form 20 November 2013

Accepted 17 December 2013

Available online 27 December 2013

Keywords:

Honeybee

Apis mellifera

Serotonin

5-HT

5-HT receptor

Gut contractions

abstract

Serotonin (5-hydroxytryptamine, 5-HT) is involved in the regulation of feeding and digestion in many

animals from worms to mammals. In insects, 5-HT functions both as a neurotransmitter and as a systemic

hormone. Here we tested its role as a neurotransmitter in feeding and crop contractions and its role as a

systemic hormone that affected feeding in adult foraging honeybees. We found 5-HT immunoreactive

processes throughout the gut, including on the surface of the oesophagus, crop, proventriculus, and

the midgut, as well as in the ventral nerve cord. mRNA transcripts for all four of the known bee 5-HT

receptors (Am5-ht

1A,2

,2b,7

) were expressed in the crop and the midgut suggesting a functional role for

5-HT in these locations. Application of a cocktail of antagonists with activity against these known recep-

tors to the entire gut in vivo reduced the rate of spontaneous contraction in the crop and proventriculus.

Although feeding with sucrose caused a small elevation of endogenous 5-HT levels in the haemolymph,

injection of exogenous 5-HT directly into the abdomen of the bee to elevate 5-HT in the haemolymph did

not alter food intake. However, when 5-HT was injected into directly into the brain there was a reduction

in intake of carbohydrate, amino acid, or toxin-laced food solutions. Our data demonstrate that 5-HT

inhibits feeding in the brain and excites muscle contractions in the gut, but general elevation of 5-HT

in the bee’s haemolymph does not affect food intake.

Ó 2013 The Authors. Published by Elsevier Ltd.

1. Introduction

The commencement and cessation of feeding is orchestrated by

a diverse set of internal cues that provide the brain with informa-

tion about nutritional state and satiety. In animals as diverse as

nematodes and humans, the biogenic amine, serotonin (5-HT), is

one of the key signalling molecules regulating feeding, nutrient

intake and digestion (Gietzen et al., 1991; Howarth et al., 2002;

Liscia et al., 2012; Marston et al., 2011; Song and Avery, 2012).

In many insects, 5-HT neurons innervate the crop and midgut

(Budnik et al., 1989; Haselton et al., 2006; Molaei and Lange,

2003; Pietrantonio et al., 2001) indicating that they are likely to

play an important role in the movement of food through the diges-

tive tract. This idea has been supported by a recent study in the

blowﬂy (Phormia regina) demonstrating that 5-HT applied to the

crop increases muscle contractions and crop emptying rate (Liscia

et al., 2012). Previous studies have also identiﬁed serotonergic var-

icosities in the foregut and midgut of other insect species including

the kissing bug, Rhodnius prolixus (Lange et al., 1989), locusts, Loc-

usta migratoria (Molaei and Lange, 2003) and Schistocerca gregaria

(Johard et al., 2003), the mosquito, Aedes aegypti (Moffett and

Moffett, 2005; Pietrantonio et al., 2001), the stable ﬂy, Stomoxys

calcitrans (Liu et al., 2011) and the ant species, Campanotus mus

(Falibene et al., 2012). In these species, innervation of the hindgut

is often less evident. The possible presence of 5-HT neurons in the

digestive tract and the functional role of 5-HT in the gut has not yet

been investigated in the honeybee.

In R. prolixus, processes in the mesothoracic ganglion project

throughout the body, and in particular, innervate the digestive

tract (Lange et al., 1989; Orchard, 2006). These neurons release

5-HT directly into the haemolymph during a blood meal, but also

orchestrate contractions of the crop and prime the animal’s phys-

iology for rapid diuresis and the digestion of blood (Lange et al.,

1989; Orchard, 2006). Experimental elevation of haemolymph 5-

HT via direct injection into the thoracic or abdominal haemolymph

in cockroaches or ﬂies (Cohen, 2001; Dacks et al., 2003; Haselton

et al., 2009) or by feeding 5-HT to ants (Falibene et al., 2012)

reduces meal size, but whether this is a general mechanism for

the regulation of feeding in insects remains unclear.

0022-1910 Ó 2013 The Authors. Published by Elsevier Ltd.

http://dx.doi.org/10.1016/j.jinsphys.2013.12.005

⇑

Corresponding author. Tel.: +44 191 222 6667.

E-mail address: [email protected] (G.A. Wright).

Journal of Insect Physiology 61 (2014) 8–15

Contents lists available at ScienceDirect

Journal of Insect Physiology

journal homepage: www.elsevier.com/locate/jinsphys

Open access under CC BY license.

brought to you by COREView metadata, citation and similar papers at core.ac.uk

provided by Elsevier - Publisher Connector

5-HT injected directly in the brain directly reduces the motor

function of the honeybee’s mouthparts (proboscis). Studies of asso-

ciative learning in honeybees indicate that 5-HT injected directly

into the brain via the median ocellar tract prior to olfactory asso-

ciative conditioning of the proboscis extension reﬂex (PER) reduces

performance during conditioning (Menzel, 1999). Honeybees can

also be trained to learn to withhold their proboscis to odours sig-

nalling rewards containing toxins (Wright et al., 2010). When the

known 5-HT receptors in the brain are blocked using a cocktail of

5-HT receptor antagonists, bees do not learn to avoid toxins in

food. They continue to extend the proboscis and feed even though

the reward contains toxins, indicating that 5-HT mediates condi-

tioned withholding of the PER (Wright et al., 2010). These two

studies indicate that 5-HT is involved in the control of motor func-

tion of PER in bees, but neither has identiﬁed whether 5-HT inhib-

its food consumption once the proboscis is extended. In addition,

no one as yet has reported whether haemolymph levels of 5-HT

in the honeybee are elevated by feeding, and whether elevation

of 5-HT in the haemolymph reduces food consumption by bees.

Here, we tested several hypotheses regarding the role of 5-HT in

feeding the brain, gut, and ventral nerve chord of the honeybee.

First, we tested whether 5-HT played a role in digestion by using

immunohistochemical methods to identify 5-HT processes in the

gut and ventral nerve chord. The four known 5-HT receptor homo-

logues in bees have been measured and described from the brain

(Blenau and Thamm, 2011; Schlenstedt et al., 2006; Thamm

et al., 2010, 2013), but not measured elsewhere. For this reason,

we also measured whether 5-HT receptors were expressed in the

digestive tract and examined their role in digestion by measuring

whether 5-HT affected gut contractions. Because we identiﬁed

5-HT immunoreactive processes in the ventral nerve chord, our

second hypothesis tested whether systemic levels of 5-HT and/or

brain 5-HT affected food intake. We ﬁrst measured whether feed-

ing elevated haemolymph 5-HT as shown in R. prolixus using HPLC

methods. To test whether elevation of haemolymph 5-HT reduced

food intake, we injected 5-HT into the abdomen and measured the

consumption of sucrose solution. To verify that elevation of 5-HT in

the brain but not haemolymph affected feeding, we injected 5-HT

into the brain prior to assaying the total food consumption of three

different types of liquid food encountered by honeybees.

2. Materials and methods

2.1. Insects

Honeybee colonies (Apis mellifera mellifera) were obtained from

stock of the National Bee Unit (FERA, York, UK). During the months

of January–March 2011 bees were maintained in an indoor ﬂight

room at a temperature of 28 °C with a 12-h light/dark cycle. During

the months of May–September 2011 and 2012, bees were kept

outdoors and allowed to forage freely. Adult foraging worker bees

were collected in small plastic vials from outside the colony

entrance. Foragers were identiﬁed as they were ﬂying back into

the colony and collected at the entrance.

2.1.1. Immunohistochemistry

Using bees collected as described above, ventral nerve cords

(VNC; N = 4), and digestive tracts (N = 8) were dissected in air

and ﬁxed for 1–3 h in 4% paraformaldehyde in 0.1 M phosphate

buffered saline (PBS). Tissue was washed in PBS with agitation (3

changes: 10 min each) and then probed with rabbit anti-5-HT anti-

serum (Sigma–Aldrich, product code S5545) diluted (1:400) in 10%

normal goat serum (Sigma–Aldrich, G9023) and 0.1% Triton X in

PBS (NGS/PBST) for 18 h at 4 °C. Control tissues (N = 4 for VNC

and N = 8 for guts) were incubated in diluent only. After

incubation, probed and control tissues were ﬁrst washed in PBS

with agitation (3 changes: 10 min each) and incubated in biotinyl-

ated goat anti-rabbit antiserum (Vectalabs, BA-1000) in NGS/PBST

(1:200) for 2 h at room temperature (RT), then washed in PBS with

agitation (3 changes: 10 min each) and incubated in Fluorescein

Avidin D (Vectalabs, A-2001) in NGS/PBST (1:200) for 1 h at RT in

darkness. The tissue was washed a ﬁnal time in PBS as before

and then mounted on microscope slides under a coverslip in Vec-

tashield mounting medium (Vectalabs, H-1500). Coverslips were

sealed with clear nail polish and stored in darkness. Control

tissues, which were incubated in diluent instead of primary

antibody showed no positive staining, indicating that the second-

ary antibodies did not bind anything expressed in the tissue. Rabbit

anti-5-HT antiserum (Sigma–Aldrich, product code S5545) is a

commercially tested antibody previously used in insect

preparations (Falibene et al., 2012), and pre-incubation of diluted

antiserum with 500

M 5-HT inhibits speciﬁc staining. Guts

incubated in 1:400 concentration (N = 8) of primary antibody were

photographed for the ﬁgures in this study, however other concen-

trations of primary antibody were also tested; 1:200 (N = 4), 1:800

(N = 2) and 1:1600 (N = 2), positive staining was observed although

best images were obtained with 1:400.

2.1.2. Microscopy

To obtain stacked images, specimens were examined and pho-

tographed under a Confocal Zeiss Axio Imager microscope (with

apotome) using an excitatory wavelength of 488 nm. Number of

Z slices and depth of Z slice interval depended on the topology

and thickness of tissue. Snap shot images were obtained using a

Leica DMRA ﬂuorescent microscope with Hamamatsu GRCA-ER

digital camera or Confocal Zeiss Axio Imager microscope. Images

were processed using Axiovision 4.8.1 software. Light microscope

images were obtained using Leica M205 C.

2.2. Quantitative real-time PCR

Tissue samples were collected, immediately frozen in liquid

nitrogen, and stored at 80 °C until use. Total RNA was extracted

using RNeasy Mini Kit (Qiagen, Hilden, Germany) and served as

template for cDNA synthesis. From each sample, two independent

cDNA syntheses from 250 ng total RNA were performed using

SuperScript III (Invitrogen, Karlsruhe, Germany) according to the

manufacturer’s instructions. Quantitative real-time PCR (qPCR)

was carried out on a Rotor Gene Q (Qiagen Hilden, Germany) by

using TaqMan technology with various ﬂuorescent dyes to allow

duplex measurements of receptor and reference gene expression.

Fluorescent dyes used as 5

-modiﬁcations were 6-FAM-phospho-

ramidite (6FAM), Cy5, Cy5.5 and Yakima Yellow (YAK). BlackBerry

quencher (BBQ) was attached to the 3

-end of TaqMan probes. The

sequences of the primers and TaqMan probes are presented in

Table 1. The PCR was performed with an initial step at 60 °C for

1 min and a denaturation step at 95 °C for 5 min, followed by 45

cycles at 95 °C for 20 s and 60 °C for 60 s. Tissue samples of individ-

ual bees were examined in triplicate. Mean copy numbers were

calculated using Rotor Gene Q software (Qiagen). Receptor tran-

script levels were normalized to elongation factor 1

(Amef-1

)

transcript levels (=100%) using the standard curve method. The

standards covered copy numbers from 10

to 10

2.3. Assay of crop and proventriculus contractions

Bees were collected from the colony, immediately chill anesthe-

tized, and then pinned to a dissecting plate dorsal side down under

‘protophormia saline’ (PPS) (Liscia et al., 2012). With the aid of a

dissecting microscope, each bee was cut from the ﬁnal abdominal

tergite upwards towards the thorax using dissection scissors; the

A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15

exoskeleton was pinned down to expose the digestive tract. After

dissection, the bee was transferred to a new dissecting dish con-

taining 5 ml PPS to cover the whole preparation; the gut remained

intact within the bee. Contractions of the crop and proventriculus

were observed and measured by eye under the microscope. We

labelled a muscle movement in either the crop or proventriculus

as a ‘contraction’ when we observed a small twitch in the wall or

a complete wave of contraction along the crop wall. These contrac-

tions were labelled as arising from the crop if they occurred at the

anterior end of the crop and arising in the proventriculus if they

were observed posteriorly in the darkened area near the midgut

(Supplementary Fig. S1).

The ﬁrst observation began 1 min after the transfer; each obser-

vation lasted 1 min, with a 5 s interval between observations.

Three observations were performed under PPS alone as a control.

After the ﬁrst 3 observations, 500

l of solution was taken out of

the body cavity and replaced with a treatment solution containing

a cocktail of antagonists against the known bee 5-HT receptors

(methiothepin mesylate, Sigma–Aldrich; ketanserin tartrate, Tocris

Biosciences) or a control solution containing the drug vehicle

(water). Water was used as the vehicle because the cocktail of

antagonists was insoluble in saline. These antagonists have previ-

ously been used against 5-HT receptors in honeybees (Wright

et al., 2010). The solution was applied directly above the crop

and allowed to perfuse the body cavity and mix with the bath solu-

tion. The ﬁnal concentration of each antagonist was 10

4

Mor10

6

M; we also tested a 10

8

M concentration, but it did not inﬂuence

contractions. Beginning one min after the replacement of the

solution, 3 one min observations were recorded with 5 s between

observations. (In a pilot study, we applied 3 concentrations of 5-HT

(10

5

,10

7

,10

9

M) to the entire gut, but did not see a measurable

change in the rate of contraction of the crop or other structures

(Supplementary Fig. S1B

.))

2.4. Measurement of 5-HT in haemolymph after feeding

Adult foragers were collected and harnessed in plastic tubes, fed

a 0.7 M sucrose solution to satiety and left on the bench (Wright

et al., 2009). Twenty-four hours later bees were fed 5

l of either

a 1.0 M sucrose solution or a 1.0 M sucrose solution containing

0.01 M amygdalin using a Gilmont syringe. Haemolymph was

extracted from the head capsules at time points 2, 5, 10, 20 and

40 min following feeding. A separate group was also measured that

had not been fed (time point 0). Using a 10

l glass capillary tube,

haemolymph was acquired from a hole pierced through

the exoskeleton of the head capsule near to the median ocellus.

The haemolymph was immediately placed into a microcentrifuge

tube containing 20

l of 0.1 M perchloric acid on ice. Composite

samples were acquired from 5 to 15 bees to a volume of 15

The sample was brought to a ﬁnal volume of 100

l with perchloric

acid, and centrifuged for 5 min at 13,000 rpm. The supernatant

taken was taken off and frozen at 20 °C. Subsamples of the hae-

molymph were diluted to a 1:4 concentration in the HPLC mobile

phase prior to analysis. Biogenic amines in 50

l samples were ana-

lysed using HPLC with electrochemical detection (Coulochem III,

ESA). A stock solution of 5-HT creatinine sulphate (Sigma–Aldrich)

3

M in 0.1 M perchloric acid was diluted to 10

9

M in mobile

phase. 50

l of the standard (50 fmol 5-HT) was injected every

10 samples to maintain calibration of calculated concentration.

The stationary phase was a C18 reverse phase column (3

microsorb, 100 mm  4.6 mm) which was maintained at 40 °C.

The mobile phase (127 mM NaH

, 1.5 mM octane sulfonic acid,

46.5 mM EDTA, 15% methanol, pH 3.7) was pumped through a

guard cell set at +350 mV, a manual injector (Rheodyne), the col-

umn and the detector at 1.1 ml/min. Eluting 5-HT was oxidised

on a porous graphite ‘frit’ ﬂow cell with E1 set at +120 mV and

E2 set at +220 mV. The resulting peak height was measured and

quantiﬁed with reference to the external standard.

2.5. Behaviour

2.5.1. Injection into head

Prior to experimentation, each bee was tested for its motivation

to feed by stimulating of the antennae with 1.0 M sucrose to elicit

the proboscis extension reﬂex (PER). Bees that did not elicit PER

were excluded from the experiment. All others were split ran-

domly into each treatment group. For the within-brain injection

experiment, bees were injected into the median ocellus with 1

of one of the following treatments: no injection, water (injection

vehicle), 10

2

,10

4

M 5-HT. Within 30 min after injection, bees

were fed to satiety using a 0.2 ml Gilmont micrometer syringe with

one of the following solutions: 1.0 M sucrose, 1.0 M sucrose con-

taining a mixture of 10 essential amino acids to mimic protein

(methionine, tryptophan, arginine, lysine, histidine, phenylalanine,

iso-leucine, threonine, leucine, valine, each at 0.01 M for a ﬁnal

sum concentration of 0.1 M), or 1.0 M sucrose containing 0.1 M

amygdalin. (All reagents were purchased from Sigma–Aldrich.)

Satiety was indicated when the bee would no longer drink the

solution and retracted its proboscis after 5 taps on the antennae

with the stimulating solution. As in Falibene et al. (2012), we also

tested how time after injection inﬂuenced feeding on 1.0 M sucrose

solution: bees injected 30 min prior to feeding exhibited greater

repression of feeding than those assayed 3 h after (Supplementary

Fig. S2).

Table 1

Sequences of primers and TaqMan probes (including 5

- and 3

-modiﬁcations; see methods) used for qPCR assays and the expected length of the resulting amplicons.

Transcript Primers and probes (5

? 3

) Amplicon size (bp)

Am5-ht1 Sense: ATGGTCGCCTGTCTGGTCAT 201

Antisense: TCGTGGATTCCTCGCCTGTAT

Probe: Cy5-TTGAGATCGGTGACTGCCCAATATCTGT-BBQ

Am5-ht2

Sense: GTCTCCAGCTCGATCACGGTT 126

Antisense: GGGTATGTAGAAGGCGATCAGAGA

Probe: Cy5-CGTGATCAACAACAGAGCGTTTTTCGT-BBQ

Am5-ht2b Sense: GAGTTTGCCACTCAGTCTGATGTACT 109

Antisense: GCAGATTATGCTGCCGATCAAC

Probe: Cy5.5-TGGTGGACGGTGCCTGTCAAA-BBQ

Am5-ht7 Sense: AATTATGTGCGACCTTTGGGTTAG 105

Antisense: GGCTTCGTTATGGCACAGAA

Probe: YAK-CACAGAGATCATGCAGAGATTCAGGATGCT-BBQ

Amef-1

Sense: GAACATTTCTGTGAAAGAGTTGAGGC 394

Antisense: TTTAAAGGTGACACTCTTAATGACGC

probe: 6FAM-ACCGAGGAGAATCCGAAGAGCATCAA-BBQ

10 A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15

2.5.2. Injection into the abdomen

For the abdominal injection experiments, bees were injected

with 1

l into the intersegmental membrane between dorsal

abdominal sterna 3 and 4 (Snodgrass, 1985) (keeping the needle

length parallel to the interior abdominal wall and oriented towards

the petiole connecting the thorax and abdomen) with one of the

following treatments: deionized water (injection vehicle), 10

2

4

,10

6

,or10

9

M 5-HT. Within 30 min of injection, each bee

was fed to satiety with 1.0 M sucrose and the amount consumed

was recorded.

2.6. Statistical analysis

Analysis of variance (ANOVA) was used to analyse the food

consumption experiments, 5-HT haemolymph and generalized

linear modelling (GLZM) was used for the receptor expression data.

5-HT haemolymph measurements were natural log transformed

prior to analysis. Gut contraction data were analysed using

repeated-measures ANOVA. Post hoc comparisons were made using

least-squares difference (lsd). All analyses were performed

using the program IBM SPSS (v.19.0).

3. Results

3.1. Digestive system

To test for 5-HT-like innervation of the gut, we examined each

area of the digestive tract of the honeybee in detail after labelling

with the 5-HT antibody (Fig. 1A). We identiﬁed 5-HT immunoreac-

tive varicosities along the entire length of the oesophagus (Fig. 1B)

which were continuous with the surface of the crop or honey stom-

ach (Fig. 1C). Several 5-HT immunoreactive ﬁbres were also identi-

ﬁed on the crop (Fig. 1C); the proventriculus was especially

densely innervated by ﬁne processes (Fig. 1D). Many of these ﬁbres

on the crop ended in clear, bleb-like structures resembling boutons

that were distributed all over the crop surface (Fig. 1E).

Dissection revealed that the midgut epithelial layer was

invaginated to form a corrugated surface. Within each midgut

invagination we observed a single stained process running circum-

ferentially (Fig. 1F); these 5-HT immunoreactive processes were

present in each corrugation of the entire length of the midgut. We

did not ﬁnd speciﬁc 5-HT immunoreactive labelling of the hypopha-

ryngeal gland, Malpighian tubules (Fig. 1G), hindgut or the rectum.

3.2. Ventral Nerve Chord (VNC)

We observed also observed 5-HT-like immunoreactive ﬁbres

throughout the VNC. In the bee, the 2nd thoracic ganglion (TG2)

is fused with the 3rd thoracic ganglion and the ﬁrst two abdominal

ganglia (Fig. 2A, Snodgrass, 1985, Dade, 1962). We found the stron-

gest 5-HT labelling in this structure (Fig. 2B and C). Fine networks

of 5-HT-like processes were identiﬁed on the dorsal surface of the

ganglion, but we did not ﬁnd the same labelling of dorsal unpaired

medial neuron cell bodies as observed in R. prolixus (Orchard,

2006). We observed similar processes in other ganglia throughout

the VNC (Supplementary Fig. S3).

Fig. 1. Serotonin-like innervation of the gut. (A) Shows a maximum intensity projection of the dissected honey bee gut (oesophagus (Oe) – anterior, rectum (R)–posterior)

stained for 5-HT. Image is a composite of stacked and tiled images stitched together. Images acquired at 2.5 magniﬁcation. Scale bar represents 1 mm. (B) The oesophagus

descends from the oral cavity where it connects to the anterior region of the crop located in the abdomen. 5-HT processes were observed on the surface of the oesophagus.

Image is a composite of 20 Z stacks. Scale bar represents 300

m. (C) 5-HT-like immunoreactive processes in the anterior region of the crop. Image is composite of 18 Z stacks

scale bar represents 300

m. (D) The crop and mid gut are separated by a valve called the proventriculus which is also innervated my 5-HT-like immunoreactive processes.

Images is a snap shot, scale bar represents 200

m. (E) Image shows immunoreactive processes on the crop at high magniﬁcation (50) under oil immersion. Scale bar

represents 50

m. (F) Immunoreactive processes running circumferentially in midgut invaginations. Image is a snap shot. Scale bar represents 200

m. (G) Malpighian

tubules extend from the pylorus, a narrowing of the alimentary canal between the midgut and hindgut. No tissue speciﬁc staining was observed. Image is a composite of 14 z

stacks. Scale bar represents 75

m. Oe, oesophagus; Cr, crop; Pv, proventriculus; MG, midgut, Py, pylorus, MT, Malpighian tubules, HG, hind gut, R, rectum.

A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15

3.3. 5-HT receptor expression in the crop and the midgut

Transcripts of all 5-HT receptor genes (Am5-ht1A, Am5-ht2

Am5-ht2b and Am5-ht7) could be detected in the crop and the mid-

gut (Fig. 3). For all 4 receptors, the pattern of receptor mRNA

expression depended on the location (2- way GLZM, receptor  tis-

sue:

¼ 198, P < 0.001). The 5-HT2 receptor transcripts exhibited

greater expression levels in the crop than in the midgut. The recep-

tor Am5-ht2

mRNA transcript exhibited a 15-fold greater expres-

sion in the crop than Am5-ht2b; in the midgut, the expression of

Am5-ht2

was 54-fold greater in expression than Am5-ht2b

(Fig. 3). The level of expression of Am5-ht1A and Am5-ht7 was

not signiﬁcantly different in the crop (lsd, P = 0.137) or in the mid-

gut (lsd, P = 0.655).

3.4. Activity of 5-HT in the digestive tract

Spontaneous contractions were observed in the crop and pro-

ventriculus but not the midgut. When the 5-HT receptor antagonist

solution was applied, contractions in the crop and proventriculus

slowed or even ceased. Prior to the application of the antagonists,

the average rate of contraction of the proventriculus was 62 con-

tractions/min (Fig. 4A), whilst the average rate of contraction of

the crop was 45 contractions/min (Fig. 4B). The 10

6

M antagonist

solution reduced contractions in the crop, but a more concentrated

solution (10

4

M) was required to slow contractions in the proven-

triculus (repeated-measures ANOVA, location  treatment  time

of measurement interaction, F

2,55

= 6.24, P = 0.004). Indeed, in the

proventriculus, the 10

6

M concentration of the antagonists tended

to slightly increase contractions (Fig. 4A, repeated-measures ANO-

VA, treatment  time of measurement interaction, F

2,55

= 7.27,

P = 0.002). When the 10

6

M treatment was compared directly to

Fig. 2. Serotonergic innervation of the ventral nerve chord (VNC). (A) A schematic showing the structure of the ventral nerve chord (VNC) and associated ganglia

(TG = thoracic ganglion, AG = abdominal ganglion, not to scale); (B) 5-HT-like immunoreactive processes were distributed along the VNC, but were densest on the dorsal

surface of the 2nd thoracic ganglion (TG2) (40). Image is a composite of 30 stacked images and was taken under oil immersion. Scale bar represents 20

m; (C)

Immunoreactive processes on the dorsal surface of TG2 (63). Image is a snapshot. Scale bar represents 10

Fig. 3. Expression patterns of 5-HT receptor genes in the crop and the midgut of

adult forager honeybees determined by quantitative real-time PCR (N = 5/ tissue).

Transcript levels were normalized to Amef-1

as a reference gene. Signiﬁcant post

hoc comparisons in expression of each receptor mRNA within each tissue (crop or

midgut) are indicated with by letters (capital letters = crop; lower-case = midgut).

Signiﬁcant post hoc comparisons for the expression of each receptor in the crop and

midgut are indicated by asterisks (indicated as

⁄

P < 0.05;

⁄⁄⁄

P < 0.001).

Fig. 4. Role of 5-HT receptors in contractions of the crop and proventriculus. (A) The rate of contraction of the muscles of the proventriculus is reduced by the10

4

concentration of a cocktail of 5-HT antagonists. (B) The rate of contraction of the muscles of the crop (not including proventriculus) is reduced by the10

6

M and 10

4

concentrations of the 5-HT antagonists (post hoc lsd, 10

–6

M: P = 0.001; 10–4 M: P = 0.008). Proventriculus: N

control

= 18, N = 6/drug trt. Crop: N

control

= 18, N = 6/drug trt.

12 A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15

the control, the effect of the drug was not signiﬁcantly different

(repeated-measures ANOVA, treatment, F

2,27

= 0.436, P = 0.651;

post hoc lsd, all comparisons P > 0.05).

3.5. Measurement of haemolymph 5-HT

To test the consumption of food elevates haemolymph levels of

5-HT in the honeybee, we fed bees 5

l of sucrose or sucrose with

the nectar toxin, amygdalin, and measured 5-HT in the haemo-

lymph collected from the head capsule at speciﬁc time points after

feeding (Fig. 5). Bees fed with 1.0 M sucrose had higher concentra-

tions of 5-HT in their haemolymph on average after feeding than

bees fed with sucrose and amygdalin (2-way ANOVA, treatment

main effect, F

1,98

= 7.66, P = 0.007). However, the concentration of

5-HT in the haemolymph of bees fed with sucrose was not signif-

icantly greater at time points after feeding (post hoc lsd, all

P > 0.05). Furthermore, haemolymph 5-HT was not different at

any time point after feeding with sucrose and amygdalin (post

hoc lsd, all P > 0.05).

3.6. Injection of 5-HT into the brain suppresses feeding

Injection of 5-HT into the brain but not the abdomen reduced

food consumption. When bees were injected into the brain via

the medial ocellus with 5-HT prior to feeding and after a 24 h fast-

ing period, the amount of food they consumed was 40–50% of what

bees in the control groups (no injection or injection with vehicle)

consumed (Fig. 6A). This was true regardless of the nutritional

quality of the solution. The extent to which feeding was reduced

by 5-HT injection, however, depended on whether the solution

was carbohydrates (sucrose), a mixture of sucrose and amino acids,

or a mixture of sucrose and the toxin, amygdalin (2-way ANOVA,

food  treatment, F

6,228

= 9.60, P < 0.001). The reduction in feeding

was greater for bees fed with sucrose or sucrose containing amino

acids than for those fed with sucrose containing amygdalin. All

doses of 5-HT injected into the brain were equally effective

(2-way ANOVA, 5-HT main effect, F

1,114

= 3.09, P = 0.086). We also

compared the responses of the bees in both control groups (no

injection and water injection) and found no difference in these

controls (2-way ANOVA, main effect, F

1,114

= 0.036, P = 0.850).

To test whether the repression of feeding was affected by sys-

temic levels of 5-HT, we also injected bees in the abdomen and

measured feeding. We predicted that if 5-HT acted as a systemic

hormone as in Rhodnius, elevation of 5-HT in the haemolymph

after injection should repress feeding. However, unlike injection

in the brain via the median ocellus, general elevation of systemic

5-HT by injection into the abdomen did not reduce the

amount of sucrose solution consumed (Fig. 6B, 1-way ANOVA,

4,119

= 1.49, P = 0.208).

4. Discussion

Our data illustrate that 5-HT inhibits feeding when applied

directly to the brain, but that it is excitatory in the gut. Our data

show that bees have distinct serotonergic innervation of the diges-

tive tract and ventral nerve cord as in other insects, and express all

4 known 5-HT receptors in the midgut and the crop. Additionally,

we observed a difference in the haemolymph 5-HT level between

bees fed with sucrose and amygdalin. However, we were unable

to detect a signiﬁcant elevation of 5-HT in honeybee haemolymph

after feeding with sucrose. Furthermore, injection of 5-HT directly

into the abdomen as a means of experimentally elevating 5-HT did

not reduce feeding, but injection directly into the brain did. Below

we discuss the role of 5-HT in digestion, gut motility, and the reg-

ulation of feeding circuits in the brain of the honeybee.

5-HT-like processes have been reported in the foregut of several

insect species including ants (C. mus)(Falibene et al., 2012), fruit

ﬂies (D. melanogaster)(Budnik et al., 1989; Neckameyer, 2010),

stable ﬂies (S. calcitrans)(Liu et al., 2011), locusts (L. migratoria)

(Molaei and Lange, 2003) and mosquitos (A. aegypti)(Moffett and

Moffett, 2005; Pietrantonio et al., 2001). Our data adds evidence

to the growing literature that indicates that 5-HT neurons and their

post-synaptic receptors in these locations are involved in the con-

trol of feeding, including contractions in the insect crop (Brown,

1965; Liscia et al., 2012; Molaei and Lange, 2003). In the blowﬂy

Fig. 5. Haemolymph levels of 5-HT were higher after feeding bees 5

l of 1.0 M

sucrose (dark triangles) than when they were fed 1.0 M sucrose with 0.1 M

amygdalin (open diamonds). Dashed line indicates average level of 5-HT in unfed

bees. N = 7–11/time point for each treatment.

Fig. 6. 5-HT injection in the brain but not the haemolymph suppresses feeding in

the honeybee. (A) Injection with 5-HT in the brain reduces meal size in bees that

have been fasted for 24 h. After injection, bees were fed 1.0 M sucrose (white bars),

1.0 M sucrose with a mixture of the 10 essential amino acids (light grey bars), or a

mixture of 1.0 M sucrose with 100 mM of the toxin, amygdalin (dark grey bars).

N = 20/group. (B) Injection with 5-HT into the haemolymph of the abdomen failed

to change meal size when bees were fed with 1.0 M sucrose. All concentrations on

x-axis are of 5-HT. N > 25 per group.

A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15

(P. regina), 5-HT causes muscular contractions of the crop and

blockade of 5-HT receptors with mianserin prevents contraction

(Liscia et al., 2012). However, in locusts, 5-HT relaxes the foregut,

but does not cause contractions (Banner et al., 1987; Lange and

Chan, 2008).

Our histological and receptor expression data also suggest that

5-HT has a role in the honeybee midgut, but direct application of

excess 5-HT did not visibly affect it. However, our data are the ﬁrst

we know of that have reported that the proventriculus contrac-

tions are affected by blockade of 5-HT receptors. The differential

sensitivity of the crop and proventriculus to the antagonists sug-

gests that contractions in these two regions could be modulated

to perform different tasks, depending on the sensitivity of the

5-HT receptors to the agonist, 5-HT. This would be important as

the crop is the main organ used to store collected food such as nec-

tar which is regurgitated by foragers on return to the colony. To

regurgitate food from the crop, it would be necessary to ﬁrst close

the proventriculus, and then contract the crop muscles, to force

ﬂuid in the opposite direction through the digestive tract.

The pharmacology of the 5-HT receptor subtypes present in the

bee has been well characterised and the binding proﬁle of antago-

nist drugs has recently been determined (Blenau et al., 1995;

Schlenstedt et al., 2006; Thamm et al., 2010, 2013). For example,

in previous studies, methiothepin has been shown to block heter-

ologously expressed Am5-HT

and Am5-HT

receptors (Thamm

et al., 2010, 2013) and to act as an inverse agonist at Am5-HT

receptors (Schlenstedt et al., 2006). Interestingly, methiothepin

shows no effects at the Am5-HT

receptor (Thamm et al., 2013).

Ketanserin is an antagonist of mammalian 5-HT

receptors (McK-

enna and Peroutka, 1989) and has been shown to block presumed

5-HT

receptor agonist-mediated responses in insects (Johnson

et al., 2009; Howarth et al., 2002; Gasque et al., 2013). In the

bee, ketanserin seems to be a speciﬁc antagonist for the Am5-

receptor (Thamm et al., 2013). A previous study using a range

of 5-HT agonist and antagonist drugs presented evidence that con-

tractions in the gut of S. frugiperda larvae are mediated by 5-HT

receptors (Howarth et al., 2002). In the present study, our cocktail

of 5-HT receptor antagonists did not allow us to distinguish be-

tween the different 5-HT receptor subtypes. Based on our receptor

transcript expression data and the measurement of the gut con-

tractions, we predict that muscular contractions in the crop and

gut of the bee are also mediated mainly by the Am5-HT

receptors.

One of the hypotheses we tested in these experiments was that

feeding alters levels of 5-HT in the haemolymph, and that this, in

turn, inﬂuences the regulation of feeding as in R. prolixus and the

ﬂesh ﬂy (Cook and Orchard, 1990; Dacks et al., 2003; Maddrell

et al., 1991; Orchard, 2006). In these species, 5-HT is released from

neurohaemal sites in the CNS (Dacks et al., 2003) and abdominal

nerves associated with the mesothoracic ganglion (Lange et al.,

1989; Orchard, 2006). In our immunohistochemical assays, we

identiﬁed 5-HT-like processes all along the VNC, but the strongest

labelling was observed a on the outer dorsal surface of the 2nd tho-

racic ganglion (i.e. mesothoracic ganglion). It is likely that as in

other insects, the 5-HT-like neurons we identiﬁed in the VNC pro-

ject to the locations we identiﬁed in the oesophagus, crop, and

midgut. Unlike R. prolixus, however, we were unable to measure

a marked elevation in haemolymph 5-HT as a result of sucrose

feeding. Instead, there was a modest increase that was only

observed by comparison with 5-HT measured from bees that had

been fed a sucrose solution laced with the toxin, amygdalin. Our

direct test of this by injecting 5-HT into the abdominal haemo-

lymph also showed that injection did not reduce feeding on

1.0 M sucrose solution. Taken together, these data suggest that

changes in haemolymph 5-HT after feeding do not act directly on

circuits governing feeding behaviour in the brain of the honeybee

as in R. prolixus.

In contrast to abdominal injection, 5-HT injected directly into

brain neuropil via the median ocellus (head capsule) reduced the

amount of food that bees consumed, as shown before for the bee’s

PER (Menzel et al., 1999). Previous studies on the role of 5-HT in

appetitive learning in honeybees support the hypothesis that

5-HT exerts inhibitory regulation of the PER and proboscis motor

function. For example, when bees were injected with 5-HT prior

to conditioning, they were less likely to express conditioned PER

(Menzel et al., 1999) or PER towards water vapour (Blenau and

Erber, 1998). Furthermore, bees that had learned to withhold the

proboscis towards odours signalling food containing amgydalin

failed to exhibit conditioned withholding when their 5-HT recep-

tors were pharmacologically blocked (Wright et al., 2010). Previ-

ously, we hypothesized that 5-HT might also be a signal of

malaise released by the gut or the VNC in response to stress caused

by the ingestion of toxins (Wright, 2011). However, we instead

found that 5-HT levels were on average lower in bees fed toxin-

laced sucrose than those fed sucrose alone. Our data clarify that

5-HT does not act as a hormone released by the gut or VNC to

act directly on the brain of the bee; rather, 5-HT released within

the brain controls not only PER but also the amount of food con-

sumed once the proboscis is extended.

In the brain, our data combined with previous studies suggests

that 5-HT modulates food intake by inhibiting motor neurons in-

volved in feeding. For example, in ants, 5-HT injection reduces the

sucking-pumping activity of the mouthparts (Falibene et al., 2012).

Immunohistochemistry studies have also revealed that serotonergic

nerves innervate the mouthparts of the cockroach Periplaneta amer-

icana (Davis, 1987) and larval stable ﬂies (S. calcitrans)(Liu et al.,

2011), indicating 5-HT modulates food ingestion. It was notable that

5-HT did not completely disrupt the feeding response in the popula-

tion of bees we tested, perhaps indicating that other mechanisms are

necessary to completely shut down the feeding response. Instead,

5-HT reduced the total amount of food eaten by each subject.

We do not know which 5-HT receptors are involved in inhibit-

ing feeding in bees, but in Drosophila, mutation or pharmacological

blockade of 5-HT

receptor subtype inhibits feeding (Gasque et al.,

2013). All of the receptors are expressed in the brain, but each is

expressed in a different region. The 5-HT

receptors are expressed

in the

and b lobes of the mushroom bodies, the 5-HT

receptors

are expressed in the mushroom body intrinsic neurons and the

SOG. Both Am5-ht2

and Am5-ht2b genes are also expressed in

the brain, as has been shown by qPCR experiments (Thamm

et al., 2013). All of the 5-HT receptors could be involved in the

regulation of feeding and the inhibition of the proboscis extension

reﬂex (Wright et al., 2010), but we do not yet have the tools neces-

sary to identify how they regulate these processes.

Several articles have shown that 5-HT modulates the ingestion

of speciﬁc nutrients. Injection or ingestion of 5-HT reduces carbo-

hydrate meals in ants (C. mus), ﬂesh ﬂies (N. bullata) and cock-

roaches (R. madera)(Cohen, 2001; Dacks et al., 2003; Falibene

et al., 2012) and reduces protein meals in blowﬂies (P. regina)

(Haselton et al., 2009). One study on the cockroach (R. madera)

reported that when injected with 5-HT, cockroaches reduced their

feeding on carbohydrates but not on foods containing protein

(Cohen, 2001). Our study, in contrast, is the ﬁrst to show that in-

jected 5-HT suppresses feeding on a variety of food substrates in

the same organism, including sucrose solutions containing a toxic

substance. These data suggest that 5-HT generally inhibits the in-

take of food rather than affecting gustation for speciﬁc nutrients

and hence the stimulation of motor output towards these nutrients.

Acknowledgements

The authors would like to thank Malcolm Thompson for bee-

keeping, Trevor Booth for help with microscopy, Danny Baker for

14 A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15

help with abdominal injection experiments, and Markus Thamm

for his help in designing the qPCR experiments. This work was

funded in part by a funding from the Insect Pollinators Initiative

Grant BB/I000968/1 to G.A.W and by Grant BL 469/7-1 from the

German Science Foundation to W.B.).

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in

the online version, at http://dx.doi.org/10.1016/j.jinsphys.2013.

12.005.

References

Banner, S.E., Osborne, R.H., Cattell, K.J., 1987. The pharmacology of the isolated

foregut of the locust schistocerca-gregaria. 2. Characterization of a 5-ht2-like

receptor. Comp. Biochem. Physiol. C-Pharmacol. Toxicol. Endocrinol. 88, 139–

144

Blenau, W., May, T., Erber, J., 1995. Characterization of [

H]LSD binding to a

serotonin-sensitive site in honeybee (Apis mellifera) brain. J. Comp. Biochem.

Physiol. 112B, 377–384

Blenau, W., Erber, J., 1998. Behavioural pharmacology of dopamine, serotonin and

putative aminergic ligands in the mushroom bodies of the honeybee (Apis

Mellifera). Behav. Brain Res. 96, 115–124.

Blenau, W., Thamm, M., 2011. Distribution of serotonin (5-Ht) and its receptors in

the insect brain with focus on the mushroom bodies. Lessons from Drosophila

melanogaster and Apis mellifera. Arth. Struct. Dev. 40, 381–394.

Brown, B.E., 1965. Pharmacologically active constituents of the cockroach Corpus

cardiacum: resolution and some characteristics. Gen. Comp. Endocrinol. 5, 387–

401

Budnik, V., Wu, C.F., White, K., 1989. Altered branching of serotonin-containing

neurons in Drosophila mutants unable to synthesize serotonin and dopamine. J.

Neurosci. 9, 2866–2877

Cohen, R.W., 2001. Diet Balancing in the Cockroach Rhyparobia madera: does

serotonin regulate this behavior? J. Insect Behav. 14, 99–111

Cook, H., Orchard, I., 1990. Effects of 5,7-Dht upon feeding and serotonin content of

various tissues in Rhodnius prolixus. J. Insect Physiol. 36, 361–367.

Dacks, A.M., Nickel, T., Mitchell, B.K., 2003. An Examination of serotonin and feeding

in the ﬂesh ﬂy Neobellieria bullata (Sarcophagidae : Diptera). J. Insect Behav. 16,

1–21

Dade, H.A., 1962. Anatomy & Dissection of the Honeybee. International Bee

Research Association Press, Cardiff, UK

Davis, N.T., 1987. Neurosecretory neurons and their projections to the serotonin

neurohemal system of the cockroach Periplaneta americana (L), and

identiﬁcation of mandibular and maxillary motor neurons associated with

this system. J. Comp. Neurol. 259, 604–621

Falibene, A., Rossler, W., Josens, R., 2012. Serotonin depresses feeding behaviour in

ants. J. Insect Physiol. 58, 7–17

Gasque, G., Conway, S., Huang, J., Rao, Y., Vosshall, L. B., 2013. small molecule drug

screening in Drosophila identiﬁes the 5ht2a receptor as a feeding modulation

target. Sci Rep., 3.

Gietzen, D.W., Duke, C.M., Hammer, V.A., 1991. Amino-acid imbalance, a nutritional

model-serotonin3 mediation of aversive responses. Physiol. Behav. 49, 981–

985

Haselton, A.T., Downer, K.E., Zylstra, J., Stoffolano, J.G., 2009. Serotonin inhibits

protein feeding in the blow ﬂy, Phormia regina (Meigen). J. Insect Behav. 22,

452–463

Haselton, A.T., Yin, C.M., Stoffolano, J.G., 2006. Occurrence of serotonin

immunoreactivity in the central nervous system and midgut of adult female

Tabanus nigrovittatus (Diptera : Tabanidae). J. Med. Entomol. 43, 252–257.

Howarth, C.J., Prince, R.I., Dyker, H., Losel, P.M., Seinsche, A., Osborne, R.H., 2002.

Pharmacological characterisation of 5-hydroxytryptamine-induced contractile

effects in the isolated gut of the Lepidopteran Caterpillar Spodoptera Frugiperda.

J. Insect Physiol. 48, 43–52

Johard, H.A.D., Coast, G.M., Mordue, W., Nassel, D.R., 2003. diuretic action of the

peptide locustatachykinin i. Cellular localisation and effects on ﬂuid secretion in

malpighian tubules of locusts. Peptides 24, 1571–1579

Johnson, O., Becnel, J., Nichols, C.D., 2009. Serotonin 5-HT

and 5-HT

-like

receptors differentially modulate aggressive behaviors in Drosophila

melanogaster. Neuroscience 158 (4), 1292–1300.

Lange, A.B., Chan, K., 2008. Dopaminergic control of foregut contractions in Locusta

migratoria. J. Insect Physiol. 54, 222–230.

Lange, A.B., Orchard, I., Barrett, F.M., 1989. Changes in hemolymph serotonin levels

associated with feeding in the bloodsucking bug, Rhodnius prolixus. J. Insect

Physiol. 35, 393–400

Liscia, A., Solari, P., Gibbons, S.T., Gelperin, A., Stoffolano, J.G., 2012. Effect of

serotonin and calcium on the supercontractile muscles of the adult blowﬂy

crop. J. Insect Physiol. 58, 356–366

Liu, S.S., Li, A.Y., Witt, C.M., de Leon, A.A.P., 2011. Immunohistological localization of

serotonin in the Cns and Ieeding system of the stable ﬂy Stomoxys calcitrans L.

(Diptera: Muscidae). Arch. Insect Biochem. Physiol. 77, 199–219

Maddrell, S.H.P., Herman, W.S., Mooney, R.L., Overton, J.A., 1991. 5-

Hydroxytryptamine – a 2nd diuretic hormone in Rhodnius prolixus. J. Exp.

Biol. 156, 557–566

Marston, O.J., Garﬁeld, A.S., Heisler, L.K., 2011. Role of central serotonin and

melanocortin systems in the control of energy balance. Eur. J. Pharmacol. 660,

70–79

McKenna, D.J., Peroutka, S.J., 1989. Differentiation of 5-hydroxytryptamine2

receptor subtypes using

125

I-R-()2,5-dimethoxy-4-iodo-

phenylisopropylamine and 3H-ketanserin. J. Neurosci. 9 (10), 3482–3490

Menzel, R., 1999. Memory dynamics in the honeybee. J. Comp. Physiol. A

Neuroethol. Sensory Neural Behav. Physiol. 185, 323–340

Menzel, R., Heyne, A., Kinzel, C., Gerber, B., Fiala, A., 1999. Pharmacological

dissociation between the reinforcing, sensitizing, and response-releasing

functions of reward in honeybee classical conditioning. Behav. Neurosci. 113,

744–754

Moffett, S. B., Moffett, D. F., 2005. Comparison of immunoreactivity to serotonin,

FMRFamide and SCPb in the gut and visceral nervous system of larvae, pupae

and adults of the yellow fever mosquito Aedes aegypti. J. Insect Sci. 5.

Molaei, G., Lange, A.B., 2003. The association of serotonin with the alimentary canal

of the African migratory locust, Locusta migratoria: distribution, physiology and

pharmacological proﬁle. J. Insect Physiol. 49, 1073–1082

Neckameyer, W.S., 2010. A trophic role for serotonin in the development of a simple

feeding circuit. Dev. Neurosci. 32, 217–237

Orchard, I., 2006. Serotonin: a coordinator of feeding-related physiological events in

the blood-gorging bug, Rhodnius prolixus. Comp. Biochem. Physiol. A Mol. Integr.

Physiol. 144, 316–324

Pietrantonio, P.V., Jagge, C., McDowell, C., 2001. Cloning and expression analysis of a

5ht7-like serotonin receptor cdna from mosquito Aedes aegypti female

excretory and respiratory systems. Insect Mol. Biol. 10, 357–369

Schlenstedt, J., Balfanz, S., Baumann, A., Blenau, W., 2006. Am 5-Ht7: molecular and

pharmacological characterization of the ﬁrst serotonin receptor of the honeybee

(Apis mellifera). J. Neurochem. 98, 1985–1998.

Snodgrass, R.E., 1985. Anatomy of the Honey Bee. Cornell University Press, Ithaca,

Song, B.M., Avery, L., 2012. Serotonin activates overall feeding by activating two

separate neural pathways in Caenorhabditis elegans. J. Neurosci. 32, 1920–1931.

Thamm, M., Balfanz, S., Scheiner, R., Baumann, A., Blenau, W., 2010. Characterization

of the 5-ht1a receptor of the honeybee (Apis mellifera) and involvement of

serotonin in phototactic behavior. Cell. Mol. Life Sci. 67, 2467–2479

Thamm, M., Rolke, D., Jordan, N., Schiffer, C., Baumann, A., Blenau, W., 2013.

Function and distribution of 5-HT

receptors in the honeybee (Apis mellifera).

PLOS ONE 8 (12), e52407

Wright, G.A., 2011. The role of dopamine and serotonin in conditioned food aversion

learning in the honeybee. Commun. Integr. Biol. 4 (3), 318–320

Wright, G.A., Carlton, M., Smith, B.H., 2009. A honeybee’s ability to learn, recognize,

and discriminate odors depends upon odor sampling time and concentration.

Behav. Neurosci. 123, 36–43

Wright, G.A., Mustard, J.A., Simcock, N.K., Ross-Taylor, A.A.R., McNicholas, L.D.,

Popescu, A., Marion-Poll, F., 2010. Parallel reinforcement pathways for

conditioned food aversions in the honeybee. Curr. Biol. 20, 2234–2240

A.S. French et al. / Journal of Insect Physiology 61 (2014) 8–15